Stem-loop sequence sly-MIR7981f

AccessionMI0033700 (change log)
DescriptionSolanum lycopersicum miR7981f stem-loop
Stem-loop
   --       a    cu                                          u            uaa                   u      c      cuaucuugugggcccaacgau 
5'   uaugcuc aaau  cagagacacacuuauacuauacuaagguccuauuaccccccu aacuuauuuuau   uaauuuuuuaccccuuuuu agcuua guggca                     g
     ||||||| ||||  |||||||||||||||||||||||||||||||||||||||||| ||||||||||||   ||||||||||||||||||| |||||| ||||||                      
3'   auacggg uuua  gucucugugugaauaugauaugauuccaggauaaugggggga uugaauaaaaua   auuaaaagauggggaaaaa ucggau caccgu                     g
   gg       c    ag                                          c            uac                   -      u      aaucaagucuuuuuuucaguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 34556987-34557241 [+]
intergenic
Database links

Mature sequence sly-miR7981f

Accession MIMAT0042026
Sequence

227 - 

aagugugucucuggaauuucgggc

 - 250

Get sequence
Evidence experimental; Illumina [1]

References

1