Stem-loop sequence sly-MIR169f

AccessionMI0033702 (change log)
DescriptionSolanum lycopersicum miR169f stem-loop
Literature search

16 open access papers mention sly-MIR169f
(45 sentences)

Stem-loop
   --  u a     aa   ug  uu         --  u     ugaa     uuaacuaau            a 
5'   uc g uagcc  gga  ac  gccuaaaau  ca uuuua    ggguc         uaaacuuuaguu c
     || | |||||  |||  ||  |||||||||  || |||||    |||||         |||||||||||| u
3'   ag c aucgg  ucu  ug  cggauuuua  gu aaaau    ucuag         auuugaaauuaa a
   ag  u a     ag   gu  --         ag  u     ----     -uauauuau            a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr3: 60099187-60099324 [+]
intergenic
Database links

Mature sequence sly-miR169f

Accession MIMAT0042028
Sequence

113 - 

uaggcguugucugaggcuaac

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1