![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sly-MIR171f |
|||||
Accession | MI0033712 (change log) | ||||
Description | Solanum lycopersicum miR171f stem-loop | ||||
Literature search |
![]()
22 open access papers mention sly-MIR171f | ||||
Stem-loop |
--ucu c c -cacau uu 5' gauauuggc ugguuca ucaga auua u ||||||||| ||||||| ||||| |||| u 3' cuauaacug gccgagu aguuu uagu g ugacu u u ucauuu ua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sly-miR171f |
|
Accession | MIMAT0042038 |
Sequence |
6 - uauuggccugguucacucaga - 26 |
Evidence | experimental; Illumina [1] |
References |
|
1 |
PMID:25218481
"Prediction and characterization of Tomato leaf curl New Delhi virus (ToLCNDV) responsive novel microRNAs in Solanum lycopersicum"
Virus Res. 195:183-195(2015).
|