Stem-loop sequence lja-MIR164

AccessionMI0035755 (change log)
DescriptionLotus japonicus miR164 stem-loop
Literature search

1 open access papers mention lja-MIR164
(1 sentences)

Stem-loop
        gagu      u   -   c        ag       c        cc  uc   au 
5' gauug    ggaggg gaa cca gcuggaga  cagggca augcuuga  uc  gaa  u
   |||||    |||||| ||| ||| ||||||||  ||||||| ||||||||  ||  |||  a
3' uuaac    ccucuu cuu ggu cgaccucu  gucucgu uacgagcu  ag  cuu  a
        --au      u   a   a        cg       a        --  -u   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr3: 34602134-34602252 [-]
intergenic
Database links

Mature sequence lja-miR164-5p

Accession MIMAT0043726
Sequence

22 - 

acgcuggagaagcagggcac

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).