Stem-loop sequence lja-MIR398

AccessionMI0035857 (change log)
DescriptionLotus japonicus miR398 stem-loop
Literature search

1 open access papers mention lja-MIR398
(2 sentences)

Stem-loop
   -gauugu            a    g   a          c  c      uugaauugu    -uc           
5'        uuaucucagagg guga cuu agaacacaag ug auuggu         uaua   auauacuaga 
          |||||||||||| |||| ||| |||||||||| || ||||||         ||||   ||||||||| a
3'        aauggaguuucc cacu gga ucuuguguuc au uaauca         guau   uauaugaucu 
   cuugucc            c    -   c          u  u      -------uu    uuc           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr3: 16612795-16612935 [+]
intergenic
Database links

Mature sequence lja-miR398-5p

Accession MIMAT0043858
Sequence

18 - 

gagugagcuuaagaacacaagc

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lja-miR398-3p

Accession MIMAT0043859
Sequence

105 - 

uuguguucucaggucaccccu

 - 125

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).