Stem-loop sequence lja-MIR168

AccessionMI0035878 (change log)
DescriptionLotus japonicus miR168 stem-loop
Literature search

1 open access papers mention lja-MIR168
(1 sentences)

Stem-loop
        ---    uc  ua     c          u     a   cugcug  ucu    uuuuc   c      a   ac 
5' gcuuc   gcgg  uc  auucg uuggugcagg cggga ccg      cu   gccg     gcg guaauc cuc  c
   |||||   ||||  ||  ||||| |||||||||| ||||| |||      ||   ||||     ||| |||||| |||  g
3' cgaag   cgcc  ag  uaagu aacuacguuc gcccu ggc      gg   uggc     cgc cauugg gag  g
        uuc    ca  gc     c          c     a   ----ua  --u    --cgc   -      c   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr2: 25511662-25511812 [-]
intergenic
Database links

Mature sequence lja-miR168-5p

Accession MIMAT0043887
Sequence

18 - 

ucgcuuggugcaggucgggaac

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence lja-miR168-3p

Accession MIMAT0043888
Sequence

112 - 

ucccgccuugcaucaacugaau

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).