Stem-loop sequence lja-MIR1511

AccessionMI0035928 (change log)
DescriptionLotus japonicus miR1511 stem-loop
Literature search

1 open access papers mention lja-MIR1511
(2 sentences)

Stem-loop
   --            uaa    c      ua   gu    u  uca 
5'   uucaugguauca   ccug uucacu  gug  cuug gu   a
     ||||||||||||   |||| ||||||  |||  |||| ||   a
3'   aaguaccauagu   ggac aagugg  uac  gaac cg   u
   cg            cuc    c      --   ac    u  uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr2: 22969019-22969107 [+]
intergenic
Database links

Mature sequence lja-miR1511-3p

Accession MIMAT0043950
Sequence

66 - 

aaccaggcucugauaccaugaagc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).