Stem-loop sequence lja-MIR166

AccessionMI0035945 (change log)
DescriptionLotus japonicus miR166 stem-loop
Literature search

1 open access papers mention lja-MIR166
(3 sentences)

Stem-loop
       a        cu                     augaagcaaa 
5' guug ggggaaug  gucugguucgagaucauucuu          g
   |||| ||||||||  |||||||||||||||||||||          a
3' cgac ccccuuac  cggaccaggcuuuaguaagga          a
       c        uu                     aaggagccaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (lj2.5) Overlapping transcripts
Chr1: 992525-992619 [-]
intergenic
Database links

Mature sequence lja-miR166-3p

Accession MIMAT0043967
Sequence

67 - 

auuucggaccaggcuucauucccc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:25967282 "micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules" Holt DB, Gupta V, Meyer D, Abel NB, Andersen SU, Stougaard J, Markmann K New Phytol. 208:241-256(2015).