Stem-loop sequence dme-mir-11182

AccessionMI0035973 (change log)
DescriptionDrosophila melanogaster miR-11182 stem-loop
Literature search

1 open access papers mention dme-mir-11182
(5 sentences)

Stem-loop
   --                   uuuaaa 
5'   gguggagaaacaucgaugu      g
     |||||||||||||||||||      a
3'   ccaccuuuuuguagcuaca      a
   cu                   caacac 
Get sequence
Deep sequencing
606 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Release_6; GCA_000001215.4) Overlapping transcripts
chr2R: 18180151-18180205 [-]
intergenic
Database links

Mature sequence dme-miR-11182

Accession MIMAT0043998
Sequence

34 - 

cacaucgauguuuuuccaccuc

 - 55

Get sequence
Deep sequencing599 reads, 47 experiments
Evidence experimental; Illumina [1]

References

1
PMID:25892215 "The 3'-5' exoribonuclease Dis3 regulates the expression of specific microRNAs in Drosophila wing imaginal discs" Towler BP, Jones CI, Viegas SC, Apura P, Waldron JA, Smalley SK, Arraiano CM, Newbury SF RNA Biol. 12:728-741(2015).