Stem-loop sequence rno-mir-709

AccessionMI0036345 (change log)
DescriptionRattus norvegicus miR-709 stem-loop
Literature search

4 open access papers mention rno-mir-709
(33 sentences)

Stem-loop
   u        -       uucuacucagaaaugcccugaguguacaa 
5'  guccucuu ucucugc                             c
    |||||||| |||||||                             u
3'  uaggagaa ggagacg                             g
   -        c       gaggggucacgaccuugugaccccuuccu 
Get sequence
Deep sequencing
114 reads, 1.28 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr19: 25200848-25200940 [+]
intergenic
Database links

Mature sequence rno-miR-709

Accession MIMAT0044471
Sequence

74 - 

ggaggcagaggcaagagga

 - 92

Get sequence
Deep sequencing108 reads, 82 experiments
Evidence by similarity; MI0004693

References

1
" Qi QE Unpublished (2015).