Stem-loop sequence fve-MIR156b

AccessionMI0036350 (change log)
DescriptionFragaria vesca miR156b stem-loop
Stem-loop
   u            -           -a       u   ug  ag 
5'  guugacagaaga gagugagcaca  cccggca ugg  ga  a
    |||||||||||| |||||||||||  ||||||| |||  ||  g
3'  cgacugucuucu cucgcucgugu  ggguugu acu  uu  a
   a            u           ga       c   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 29883628-29883716 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR156b
fve-MIR156bLG3: 29883628-29883716 [+]
fve-MIR156aLG3: 29884140-29884268 [+]
fve-MIR156fLG3: 29884562-29884692 [+]
Database links

Mature sequence fve-miR156b

Accession MIMAT0044476
Sequence

3 - 

uugacagaagagagugagcac

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1