Stem-loop sequence fve-MIR156f

AccessionMI0036355 (change log)
DescriptionFragaria vesca miR156f stem-loop
Stem-loop
   uacga      -  a      --gu -       aaagaggauucauggugcagggaggauauggau 
5'      gcuuuc au cuuuug    c ugauucu                                 a
        |||||| || ||||||    | |||||||                                  
3'      cgagag ua gaagac    g auuaagg                                 u
   caaca      a  -      aguu u       aguauugguagguaucuaguaaucuagucagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 29884562-29884692 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR156f
fve-MIR156bLG3: 29883628-29883716 [+]
fve-MIR156aLG3: 29884140-29884268 [+]
fve-MIR156fLG3: 29884562-29884692 [+]
Database links

Mature sequence fve-miR156f

Accession MIMAT0044481
Sequence

108 - 

uugacagaagauagagagcac

 - 128

Get sequence
Evidence experimental; Illumina [1]

References

1