Stem-loop sequence fve-MIR156g

AccessionMI0036356 (change log)
DescriptionFragaria vesca miR156g stem-loop
Stem-loop
   gu  u         -              u   -   cu    au 
5'   ug ugacagaag auagagagcacaga gga uga  ugca  g
     || ||||||||| |||||||||||||| ||| |||  ||||  a
3'   ac acugucuuc uaucucucguguuu ccu acu  acgu  a
   cc  u         g              -   c   cu    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG5: 10354925-10355014 [-]
intergenic
Database links

Mature sequence fve-miR156g-5p

Accession MIMAT0044482
Sequence

5 - 

uugacagaagauagagagcac

 - 25

Get sequence
Evidence experimental; Illumina [1]

Mature sequence fve-miR156g-3p

Accession MIMAT0044483
Sequence

67 - 

gcucucuaugcuucugucauc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1