Stem-loop sequence fve-MIR156h

AccessionMI0036357 (change log)
DescriptionFragaria vesca miR156h stem-loop
Stem-loop
    g          -     -      u  g        --uu    --     uacu   uuu 
5' g ggcugacaga agaga gugagc ca auuacaca    ugua  augag    aag   a
   | |||||||||| ||||| |||||| || ||||||||    ||||  |||||    |||    
3' c ucgacugucu ucucu cacucg gu uaaugugu    acau  uacuc    uuc   u
    g          a     u      u  g        uuau    cg     ---c   uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG1: 192274-192390 [+]
intergenic
Database links

Mature sequence fve-miR156h

Accession MIMAT0044484
Sequence

6 - 

ugacagaagagagugagcuc

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1