Stem-loop sequence fve-MIR156j

AccessionMI0036359 (change log)
DescriptionFragaria vesca miR156j stem-loop
Stem-loop
   u            -       c   -a       u   ug  ag 
5'  guugacggaaga gagcgag aca  cccggca ugg  aa  a
    |||||||||||| ||||||| |||  ||||||| |||  ||  g
3'  cgacugccuucu cuugcuc ugu  ggguugu acc  uu  a
   g            u       a   ga       c   gu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 5986597-5986685 [-]
intergenic
Clustered miRNAs
< 10kb from fve-MIR156j
fve-MIR156jLG3: 5986597-5986685 [-]
fve-MIR156cLG3: 5985819-5985907 [-]
Database links

Mature sequence fve-miR156j

Accession MIMAT0044486
Sequence

3 - 

uugacggaagagagcgagcac

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1