Stem-loop sequence fve-MIR160b

AccessionMI0036363 (change log)
DescriptionFragaria vesca miR160b stem-loop
Stem-loop
          c       cu          ug a   a  u     a 
5' uaugugc uggcucc  guaugccauu  c gag gc caucg a
   ||||||| |||||||  ||||||||||  | ||| || ||||| c
3' guauacg accgagg  uaugcgguag  g cuc cg guagc a
          u       ag          gu c   -  -     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG7: 14469085-14469173 [-]
intergenic
Database links

Mature sequence fve-miR160b

Accession MIMAT0044491
Sequence

5 - 

ugccuggcucccuguaugcca

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1