Stem-loop sequence fve-MIR164a

AccessionMI0036366 (change log)
DescriptionFragaria vesca miR164a stem-loop
Stem-loop
            uu  uc          ca            -aaccc       aau 
5' aggugaggg  cc  guuggagaag  gggcacgugcaa      uucggcu   a
   |||||||||  ||  ||||||||||  ||||||||||||      |||||||    
3' ucuacuccu  gg  caaccucuuc  cucgugcacguu      aagucga   c
            ug  ua          cc            cucgaa       cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 16008057-16008167 [-]
intergenic
Database links

Mature sequence fve-miR164a-5p

Accession MIMAT0044495
Sequence

18 - 

uggagaagcagggcacgugca

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence fve-miR164a-3p

Accession MIMAT0044496
Sequence

76 - 

cacgugcuccccuucuccaac

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1