Stem-loop sequence fve-MIR166b

AccessionMI0036371 (change log)
DescriptionFragaria vesca miR166b stem-loop
Stem-loop
        uc     --c  u     a        cu g           c  a    --a   g  --------   a 
5' augag  ugaaa   ug uguug ggggaaug  g cugguucgaga ca uauu   gug uc        ugc g
   |||||  |||||   || ||||| ||||||||  | ||||||||||| || ||||   ||| ||        ||| c
3' uacuu  acuuu   au auaac ccccuuac  c gaccaggcucu gu guaa   cac ag        gcg a
        --     caa  c     c        uu g           a  a    guc   g  uacaagaa   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG4: 2660780-2660920 [-]
intergenic
Clustered miRNAs
< 10kb from fve-MIR166b
fve-MIR166bLG4: 2660780-2660920 [-]
fve-MIR166aLG4: 2653237-2653378 [-]
Database links

Mature sequence fve-miR166b

Accession MIMAT0044501
Sequence

99 - 

ucggaccaggcuucauucccc

 - 119

Get sequence
Evidence experimental; Illumina [1]

References

1