Stem-loop sequence fve-MIR167d

AccessionMI0036375 (change log)
DescriptionFragaria vesca miR167d stem-loop
Stem-loop
   u      -     uc    u           g        caa c        a 
5'  ucgugu acaag  auag ugaagcugcca caugaucu   c ucucucag u
    |||||| |||||  |||| ||||||||||| ||||||||   | ||||||||  
3'  aguacg uguuu  uguc acuuugauggu guacuaga   g agggaguc u
   a      a     gu    c           -        cuc a        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG4: 815457-815564 [+]
intergenic
Database links

Mature sequence fve-miR167d

Accession MIMAT0044506
Sequence

20 - 

ugaagcugccagcaugaucuca

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1