Stem-loop sequence fve-MIR167c

AccessionMI0036377 (change log)
DescriptionFragaria vesca miR167c stem-loop
Stem-loop
        a    - -c              uu      cau      - aa 
5' aguga gcug c  agcaugaucuagcu  gguuau   guagau c  g
   ||||| |||| |  ||||||||||||||  ||||||   |||||| |   
3' ucacu cgac g  ucguacuggaucga  ccaaua   cgucua g  u
        c    a uc              uc      -au      a cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 14554218-14554313 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR167c
fve-MIR167cLG2: 14554218-14554313 [+]
fve-MIR167aLG2: 14557555-14557673 [+]
Database links

Mature sequence fve-miR167c

Accession MIMAT0044508
Sequence

3 - 

ugaagcugccagcaugaucu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1