Stem-loop sequence fve-MIR167a

AccessionMI0036378 (change log)
DescriptionFragaria vesca miR167a stem-loop
Stem-loop
          -   cuu    u     c     g        aag   c   cuc   -  guu 
5' ucgugga uca   gcag ugaag ugcca caugaucu   cuu ccu   ggc cg   g
   ||||||| |||   |||| ||||| ||||| ||||||||   ||| |||   ||| ||    
3' agcacuu ggu   uguc acuuc acggu guacuaga   gaa gga   cug gc   u
          c   agu    c     a     -        cua   a   --a   a  aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 14557555-14557673 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR167a
fve-MIR167cLG2: 14554218-14554313 [+]
fve-MIR167aLG2: 14557555-14557673 [+]
Database links

Mature sequence fve-miR167a

Accession MIMAT0044509
Sequence

19 - 

ugaagcugccagcaugaucu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1