Stem-loop sequence fve-MIR169d

AccessionMI0036383 (change log)
DescriptionFragaria vesca miR169d stem-loop
Stem-loop
        uaaa        u   -u      c     ug          acuaaa  a    ---c       -u             c 
5' gaagg    aagagcca guu  gguagc aagga  acuugccuaa      uc ucca    agcuugg  uucuaguuagcug u
   |||||    |||||||| |||  |||||| |||||  ||||||||||      || ||||    |||||||  |||||||||||||  
3' cuuuc    uucucggu cag  ucaucg uuccu  uggacggauu      ag gggu    uugaacc  gggaucgaucgau g
        --ua        -   uc      c     gu          cucucg  -    uugu       uu             c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG5: 4289807-4289973 [-]
intergenic
Database links

Mature sequence fve-miR169d

Accession MIMAT0044515
Sequence

25 - 

uagccaaggaugacuugccu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1