Stem-loop sequence fve-MIR171a

AccessionMI0036386 (change log)
DescriptionFragaria vesca miR171a stem-loop
Stem-loop
      u    aua   g        uc         a      c  c      u u 
5' gga cggu   acg gauauugg  cgguucaau agaaaa ag gcucga g g
   ||| ||||   ||| ||||||||  ||||||||| |||||| || |||||| |  
3' ccu guca   ugc cuauaacc  gccgaguua uuuuuu uc cgaguu c a
      c    ccg   a        gu         g      a  u      - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 34450103-34450211 [-]
intergenic
Database links

Mature sequence fve-miR171a

Accession MIMAT0044518
Sequence

74 - 

ugauugagccgugccaauauc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1