Stem-loop sequence fve-MIR171c

AccessionMI0036390 (change log)
DescriptionFragaria vesca miR171c stem-loop
Stem-loop
       cuuuaac   a        ug             aac   cu     c 
5' gcug       aug gauauugg  cgguucaaucaga   cag  cuuug u
   ||||       ||| ||||||||  |||||||||||||   |||  |||||  
3' cgac       uac cuauaacc  gccgaguuaguuu   guc  gaaau c
       ----aua   a        gu             auu   uu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 514668-514769 [-]
intergenic
Database links

Mature sequence fve-miR171c-5p

Accession MIMAT0044522
Sequence

15 - 

agauauuggugcgguucaauc

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence fve-miR171c-3p

Accession MIMAT0044523
Sequence

71 - 

ugauugagccgugccaauauc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1