Stem-loop sequence fve-MIR171f

AccessionMI0036393 (change log)
DescriptionFragaria vesca miR171f stem-loop
Stem-loop
   ugaauc     c          a         c  a  ca       aaacaua     gc 
5'       gaaag gauguuggug gguucaauc ga ga  gauuuac       uggcu  u
         ||||| |||||||||| ||||||||| || ||  |||||||       |||||   
3'       cuuuc cuauaaccgc ccgaguuag cu cu  uuaaaug       accgg  g
   ---auu     a          g         a  -  ag       ------c     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG1: 2548850-2548963 [-]
intergenic
Database links

Mature sequence fve-miR171f-5p

Accession MIMAT0044526
Sequence

12 - 

cgauguuggugagguucaauc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence fve-miR171f-3p

Accession MIMAT0044527
Sequence

88 - 

uugagccgcgccaauaucacu

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1