Stem-loop sequence fve-MIR172b

AccessionMI0036394 (change log)
DescriptionFragaria vesca miR172b stem-loop
Stem-loop
     g              c      a   g  ---      c       c   uuug 
5' gc ggugcagcaucauc agauuc cag uu   uuauua ugacauc uca    a
   || |||||||||||||| |||||| ||| ||   |||||| ||||||| |||     
3' cg cuacgucguaguag ucuaag guu ag   aguagu acuguag agu    a
     a              u      a   g  ccu      -       -   uucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG7: 13952785-13952893 [+]
intergenic
Database links

Mature sequence fve-miR172b

Accession MIMAT0044528
Sequence

85 - 

agaaucuugaugaugcugcau

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1