Stem-loop sequence fve-MIR172c

AccessionMI0036395 (change log)
DescriptionFragaria vesca miR172c stem-loop
Stem-loop
        -  u  u g                      a  -     uuaaccgaaaggu 
5' aguca gu cu g uggugcggcaucaucaagauuc ca uacuu             u
   ||||| || || | |||||||||||||||||||||| || |||||              
3' ucagu ca ga c acuacgucguaguaguucuaag gu augaa             c
        a  u  u g                      a  c     ugaaguuaccgua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 23263564-23263679 [+]
intergenic
Database links

Mature sequence fve-miR172c

Accession MIMAT0044529
Sequence

80 - 

agaaucuugaugaugcugcau

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1