Stem-loop sequence fve-MIR2109

AccessionMI0036397 (change log)
DescriptionFragaria vesca miR2109 stem-loop
Stem-loop
       -     a  gc    c      c   a  u        ucuuucu     ag 
5' ggcg gcgug ag  ucug gagugu uuc cc cugaagcc       gaaga  c
   |||| ||||| ||  |||| |||||| ||| || ||||||||       |||||   
3' ccgc cgcac uc  agac cucaca aag gg gacuucgg       cuucu  u
       u     a  ac    u      u   c  -        -uuuguu     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG0: 1732169-1732279 [+]
intergenic
Database links

Mature sequence fve-miR2109

Accession MIMAT0044531
Sequence

17 - 

ugcgagugucuucaccucugaa

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1