Stem-loop sequence fve-MIR2111c

AccessionMI0036398 (change log)
DescriptionFragaria vesca miR2111c stem-loop
Stem-loop
        c               ug   u     -    cu     uca 
5' aggau ggguaaucugcaucc  agg uuaga gcag  gcaug   u
   ||||| |||||||||||||||  ||| ||||| ||||  |||||   a
3' uccua uccauuagacguagg  ucc gaucu uguu  uguau   u
        c               gu   c     g    --     cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 8384946-8385039 [-]
intergenic
Clustered miRNAs
< 10kb from fve-MIR2111c
fve-MIR2111aLG3: 8387953-8388068 [+]
fve-MIR2111cLG3: 8384946-8385039 [-]
Database links

Mature sequence fve-miR2111c

Accession MIMAT0044532
Sequence

10 - 

uaaucugcauccugagguuu

 - 29

Get sequence
Evidence experimental; Illumina [1]

References

1