Stem-loop sequence fve-MIR390b

AccessionMI0036405 (change log)
DescriptionFragaria vesca miR390b stem-loop
Stem-loop
       u           ua          g         c  u    c  -u  uu g 
5' agua ggaagaaucug  aagcucagga ggauagcgc au uaug cu  gc  g a
   |||| |||||||||||  |||||||||| ||||||||| || |||| ||  ||  | u
3' ucau ucuucuugggu  uuuggguccu ccuaucgcg ua auac ga  cg  c u
       -           cc          a         a  u    u  uu  uu a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 7169990-7170104 [+]
intergenic
Database links

Mature sequence fve-miR390b

Accession MIMAT0044540
Sequence

19 - 

aagcucaggagggauagcgcc

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1