Stem-loop sequence fve-MIR396d

AccessionMI0036412 (change log)
DescriptionFragaria vesca miR396d stem-loop
Stem-loop
         c     g     c             a     aaag   -  uaauuau     ---a    au 
5' gauccu cuugu auuuu cacagcuuucuug acugu    ugc cu       gaacu    ggag  u
   |||||| ||||| ||||| ||||||||||||| |||||    ||| ||       |||||    ||||   
3' cuagga ggaca uaaaa gugucgaaagagc ugaca    acg ga       uuuga    ccuc  a
         c     a     a             c     -aga   a  ---caac     cgua    ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG0: 9235892-9236025 [+]
intergenic
Database links

Mature sequence fve-miR396d

Accession MIMAT0044550
Sequence

17 - 

uuccacagcuuucuugaacug

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1