Stem-loop sequence fve-MIR397

AccessionMI0036414 (change log)
DescriptionFragaria vesca miR397 stem-loop
Stem-loop
          u  --        c    a                  --    -    u       ---   u  c 
5' uucagaa ga  agaaacgu auug gugcagcguugaugaagu  ccuu aguu cguuucc   gag uc g
   ||||||| ||  |||||||| |||| ||||||||||||||||||  |||| |||| |||||||   ||| ||  
3' aggucuu cu  ucuuugua uaac cacgucgcaacuacuuua  ggag ucga gcggagg   uuc ag a
          c  ua        u    c                  ac    g    -       uac   u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 2934926-2935064 [-]
intergenic
Database links

Mature sequence fve-miR397

Accession MIMAT0044552
Sequence

18 - 

ucauugagugcagcguugaug

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1