Stem-loop sequence fve-MIR399b

AccessionMI0036416 (change log)
DescriptionFragaria vesca miR399b stem-loop
Stem-loop
        aga     aa              c     a    uguauu       -     -  u 
5' gguag   ugaau  caggguaauucucc uuggc gaaa      auggugc auuua cg a
   |||||   |||||  |||||||||||||| ||||| ||||      ||||||| ||||| ||  
3' ucauc   acuua  gucccguuaagagg aaccg cuuu      ugucacg uaaau gu a
        aaa     aa              a     a    ------       g     u  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 5220240-5220359 [+]
intergenic
Database links

Mature sequence fve-miR399b

Accession MIMAT0044554
Sequence

85 - 

agccaaaggagaauugcccug

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1