Stem-loop sequence fve-MIR408

AccessionMI0036417 (change log)
DescriptionFragaria vesca miR408 stem-loop
Stem-loop
      a      c       a     ga       cc      aaca 
5' aag caggga gagguag gcaug  uggaguu  caacag    g
   ||| |||||| ||||||| |||||  |||||||  ||||||     
3' uuc gucccu cuccguc cguac  accucgg  guuguc    u
      g      u       a     uc       -u      gaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG1: 12223023-12223113 [-]
intergenic
Database links

Mature sequence fve-miR408

Accession MIMAT0044555
Sequence

70 - 

ugcacugccucuucccuggcu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1