Stem-loop sequence fve-MIR482b

AccessionMI0036420 (change log)
DescriptionFragaria vesca miR482b stem-loop
Stem-loop
       g        a    aga       u  g    -a        guggccggaaguuguggaguggaguucugggaaagaaga 
5' gaug ugugacag gaag   aaggagu gg ggga  agggagga                                       c
   |||| |||||||| ||||   ||||||| || ||||  ||||||||                                        
3' cuac guacuguc cuuu   uuccuua cc uccu  uccuuucu                                       c
       -        -    -ag       -  g    ga        ugguuacaaaaaaaggguuuaaugaagcucuuuuuggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 2405273-2405439 [+]
intergenic
Database links

Mature sequence fve-miR482b

Accession MIMAT0044558
Sequence

126 - 

ucuuuccuaguccugccauucc

 - 147

Get sequence
Evidence experimental; Illumina [1]

References

1