Stem-loop sequence fve-MIR5225

AccessionMI0036423 (change log)
DescriptionFragaria vesca miR5225 stem-loop
Stem-loop
         cg  u    a    u    u               aaa       ugau   ugauu  a       
5' gaucga  cg aggg cuuc gucg aggagagauggcgcc   uguauga    uac     gu uaugau 
   ||||||  || |||| |||| |||| |||||||||||||||   |||||||    |||     || ||||| g
3' uuagcu  gc uccc gaag cagc uucucucuacugcgg   gcguacu    aug     cg auauuu 
         ag  -    c    u    -               gug       -uau   -ucau  -       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 1800796-1800935 [-]
intergenic
Clustered miRNAs
< 10kb from fve-MIR5225
fve-MIR3627aLG6: 1809426-1809584 [+]
fve-MIR5225LG6: 1800796-1800935 [-]
Database links

Mature sequence fve-miR5225

Accession MIMAT0044561
Sequence

20 - 

cugucguaggagagauggcgcc

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1