Stem-loop sequence fve-MIR535b

AccessionMI0036426 (change log)
DescriptionFragaria vesca miR535b stem-loop
Stem-loop
   u  u   c  u     a        u   c     c     a 
5'  gu uga ga gagag gagcacgc ugu agcau uauga a
    || ||| || ||||| |||||||| ||| ||||| ||||| c
3'  ca acu cu uucuc cucgugcg gca uugug guacu a
   a  u   a  c     c        u   u     c     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 10602901-10602987 [+]
intergenic
Database links

Mature sequence fve-miR535b

Accession MIMAT0044564
Sequence

5 - 

ugacgaugagagagagcacgc

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1