Stem-loop sequence fve-MIR11286

AccessionMI0036429 (change log)
DescriptionFragaria vesca miR11286 stem-loop
Stem-loop
   ucucc      -   -    ---   guga  u       a 
5'      ucugcu ucu ucca   acc    ug guuucug g
        |||||| ||| ||||   |||    || ||||||| u
3'      agauga aga aggu   ugg    ac cgaagac u
   guaac      g   g    ucc   ---a  -       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 12165584-12165659 [+]
intergenic
Database links

Mature sequence fve-miR11286

Accession MIMAT0044567
Sequence

56 - 

uuggagagagaguagacaaug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1