Stem-loop sequence fve-MIR11288c

AccessionMI0036431 (change log)
DescriptionFragaria vesca miR11288c stem-loop
Stem-loop
          -g     u  au ag       uu                 u   cg 
5' agaucua  cgucu cg  c  cgauucg  cggauuccaauucaaac gau  a
   |||||||  ||||| ||  |  |||||||  ||||||||||||||||| |||   
3' ucuagau  guaga gc  g  guuaagc  guuuaggguuaaguuug cug  g
          aa     -  cg ga       -u                 -   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 25353781-25353886 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR11288c
fve-MIR11288aLG3: 25352228-25352319 [+]
fve-MIR11288bLG3: 25352641-25352750 [+]
fve-MIR11288cLG3: 25353781-25353886 [+]
fve-MIR11288dLG3: 25355853-25356050 [+]
fve-MIR11288eLG3: 25359226-25359328 [+]
Database links

Mature sequence fve-miR11288c-5p

Accession MIMAT0044569
Sequence

25 - 

uucguucggauuccaauucaaa

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence fve-miR11288c-3p

Accession MIMAT0044570
Sequence

64 - 

ugaauugggauuugucgaauu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1