Stem-loop sequence fve-MIR11289

AccessionMI0036432 (change log)
DescriptionFragaria vesca miR11289 stem-loop
Stem-loop
   ugaau      a  --c     a  ac    u  cu aaaucaucuuucuugccucuuaggg 
5'      gcuuca gu   uggcc au  uugc cg  c                         u
        |||||| ||   ||||| ||  |||| ||  |                         u
3'      cggagu cg   accgg ua  aacg gc  g                         u
   aacac      c  cuu     c  ga    -  cu acaugaccaaguguuuaccuacuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG1: 6290557-6290680 [-]
intergenic
Database links

Mature sequence fve-miR11289

Accession MIMAT0044571
Sequence

5 - 

ugcuucaagucuggccaauacu

 - 26

Get sequence
Evidence experimental; Illumina [1]

References

1