Stem-loop sequence fve-MIR11296

AccessionMI0036440 (change log)
DescriptionFragaria vesca miR11296 stem-loop
Stem-loop
     --ua       c    c   c            c     u     -  gaacuu    a 
5' cc    agauuuu uuug uuu uuuuuuugaugg uggaa ccagu aa      aauc u
   ||    ||||||| |||| ||| |||||||||||| ||||| ||||| ||      |||| u
3' gg    uuuaaaa gaac aaa aaagaaacuacc accuu gguca uu      uuag u
     ccgg       u    u   a            u     -     c  accuac    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG7: 9816992-9817112 [-]
intergenic
Database links

Mature sequence fve-miR11296

Accession MIMAT0044579
Sequence

24 - 

uuuuugauggcuggaauccagu

 - 45

Get sequence
Evidence experimental; Illumina [1]

References

1