Stem-loop sequence fve-MIR11299

AccessionMI0036443 (change log)
DescriptionFragaria vesca miR11299 stem-loop
Stem-loop
   ---aa    c   u     ucu       a       -              a  c      u     aa  u   --------     ua 
5'      uaug auu uauua   accccaa uaggguu ggcugauacuagua uu cuuuuc uuuag  cu gga        guugc  u
        |||| ||| |||||   ||||||| ||||||| |||||||||||||| || |||||| |||||  || |||        |||||  g
3'      guac uag auagu   ugggguu aucccaa cugauuaugaucau aa gagaag aaauc  ga ccu        caaug  a
   uuaua    -   u     --u       a       a              g  a      c     -c  c   ucuuauua     cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 2213239-2213407 [-]
intergenic
Database links

Mature sequence fve-miR11299

Accession MIMAT0044582
Sequence

24 - 

caaauaggguuggcugauacu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1