Stem-loop sequence fve-MIR11300

AccessionMI0036444 (change log)
DescriptionFragaria vesca miR11300 stem-loop
Stem-loop
        c           c     ---c         cgccagaauucugacaaaaugaguuugg 
5' gucaa aucacuguucu uuccu    uaacacaac                            g
   ||||| ||||||||||| |||||    |||||||||                            a
3' uaguu uagugauaaga aaggg    guuguguug                            a
        a           c     aaau         uaaguguuggaagccucgagcuuaggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG7: 9295599-9295726 [-]
intergenic
Database links

Mature sequence fve-miR11300

Accession MIMAT0044583
Sequence

3 - 

caacaucacuguucucuuccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1