Stem-loop sequence fve-MIR11301

AccessionMI0036445 (change log)
DescriptionFragaria vesca miR11301 stem-loop
Stem-loop
     c        u   c    g       a            u   uguugc        agaggucgauaaggcc 
5' gg uccauggu gau uuca aguugua uauauugauaaa gca      aagggugg                a
   || |||||||| ||| |||| ||||||| |||||||||||| |||      ||||||||                 
3' uc agguauca cua aagu ucaacau guauaacuauuu cgu      uucccauu                a
     a        c   c    a       c            u   ------        auaugacuuuuagcac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 1429952-1430097 [+]
intergenic
Database links

Mature sequence fve-miR11301

Accession MIMAT0044584
Sequence

18 - 

ucagaguuguaauauauugau

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1