Stem-loop sequence fve-MIR11302

AccessionMI0036446 (change log)
DescriptionFragaria vesca miR11302 stem-loop
Stem-loop
      a         c         cc    a               cgguggcgguccucaacggccaccagguucuugaggaccgcc 
5' acc gguggcggu cuccaaaac  ggug cgguccuccaaaacc                                          a
   ||| ||||||||| |||||||||  |||| |||||||||||||||                                          c
3' ugg cuaccgcca gagguuuug  cuac gccaggagguuuugg                                          c
      a         a         ca    c               accaccaccaggaguucuuggaccaccgccagguauucuuga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG4: 21216321-21216497 [+]
intergenic
Database links

Mature sequence fve-miR11302

Accession MIMAT0044585
Sequence

141 - 

aggaccgccaucacguuuugg

 - 161

Get sequence
Evidence experimental; Illumina [1]

References

1