Stem-loop sequence fve-MIR11303

AccessionMI0036447 (change log)
DescriptionFragaria vesca miR11303 stem-loop
Stem-loop
     ugg             -               u  a   ucuua   aaauaa    u 
5' gg   gggagcugaacuc aaacaucacugcagc gu ugc     gcu      uuga u
   ||   ||||||||||||| ||||||||||||||| || |||     |||      ||||  
3' cc   cccucgacuugag uuuguagugaugucg ca acg     cga      aacu a
     ugg             a               u  g   ----c   -----c    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 20569546-20569657 [+]
intergenic
Database links

Mature sequence fve-miR11303

Accession MIMAT0044586
Sequence

17 - 

ucaaacaucacugcagcugua

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1