Stem-loop sequence fve-MIR11304

AccessionMI0036448 (change log)
DescriptionFragaria vesca miR11304 stem-loop
Stem-loop
       a   c     -c       u     c          uuguuuu   --uu  a 
5' aaag gau gcugc  gauagug uucag uugacaaguu       ccc    uc c
   |||| ||| |||||  ||||||| ||||| ||||||||||       |||    || u
3' uuuc cua cgacg  uuaucac agguc aacuguucaa       ggg    ag c
       c   c     uc       u     u          -----cc   uuau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG2: 4312848-4312956 [+]
intergenic
Database links

Mature sequence fve-miR11304

Accession MIMAT0044587
Sequence

18 - 

uaguguuucagcuugacaag

 - 37

Get sequence
Evidence experimental; Illumina [1]

References

1