Stem-loop sequence fve-MIR11308

AccessionMI0036452 (change log)
DescriptionFragaria vesca miR11308 stem-loop
Stem-loop
        u c     u u            a        -----   -       u 
5' gcacc g uaacu g aauccuaacuua uacuccau     uug gaucaac c
   ||||| | ||||| | |||||||||||| ||||||||     ||| ||||||| u
3' cgugg c auuga c uuaggauugaau augaggua     agc uuaguug c
        u c     u -            a        uaauu   a       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG6: 8026186-8026289 [-]
intergenic
Database links

Mature sequence fve-miR11308

Accession MIMAT0044591
Sequence

78 - 

uaaguuaggauucuaguuacc

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1