Stem-loop sequence fve-MIR11312

AccessionMI0036456 (change log)
DescriptionFragaria vesca miR11312 stem-loop
Stem-loop
              -c            u   g      u   aa    ggaac 
5' caaggcauuuu  guuaacucuccc caa ggcuuc agc  ugcc     a
   |||||||||||  |||||||||||| ||| |||||| |||  ||||     c
3' guucugugaaa  caauugagaggg guu ucgagg ucg  acgg     a
              aa            -   g      u   -a    aauac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG5: 2677133-2677234 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR11312
fve-MIR477aLG5: 2676771-2676921 [+]
fve-MIR11312LG5: 2677133-2677234 [+]
Database links

Mature sequence fve-miR11312

Accession MIMAT0044595
Sequence

67 - 

uggagcuguuggggagaguua

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1