Stem-loop sequence fve-MIR11288b

AccessionMI0036460 (change log)
DescriptionFragaria vesca miR11288b stem-loop
Stem-loop
   ucggugacgucu  -  c         g   acc     a  a     u  ag        
5'             uc cg aucaaaauu gcc   uccca uu aaacu ag  uuugaga 
               || || ||||||||| |||   ||||| || ||||| ||  |||||| u
3'             ag gc ugguuuuaa cgg   agggu aa uuuga uc  aaacucg 
   --------aguu  a  -         g   guu     c  g     -  cu        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.1) Overlapping transcripts
LG3: 25352641-25352750 [+]
intergenic
Clustered miRNAs
< 10kb from fve-MIR11288b
fve-MIR11288aLG3: 25352228-25352319 [+]
fve-MIR11288bLG3: 25352641-25352750 [+]
fve-MIR11288cLG3: 25353781-25353886 [+]
fve-MIR11288dLG3: 25355853-25356050 [+]
fve-MIR11288eLG3: 25359226-25359328 [+]
Database links

Mature sequence fve-miR11288b

Accession MIMAT0044599
Sequence

81 - 

ugggauugggcgaauuuuggu

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1